Tm Calculator

Q: Which Tm method should I use for PCR?

Use Nearest Neighbor for most work. It is the most accurate and matches what most primer design software reports. Use Polymerase-specific when you want a ready-to-use annealing temperature for your enzyme. Use Basic Tm only for a fast check or when your primer has mixed bases.

Tm Calculator

Updated Aug 24, 2026 By Jehan Wadia

Introduction

This Tm calculator finds the melting temperature (Tm) of your DNA primers. Tm is the temperature where half of the primer is stuck to its target DNA and half has come apart. Knowing this number helps you pick the right annealing temperature for PCR, so your reaction works instead of failing.

Just paste in a primer sequence, or two if you have a forward and reverse pair. The tool counts your bases, works out the GC content, and gives you the Tm right away. You can also enter many primer pairs at once in batch mode.

Pick from three ways to get your answer:

Basic Tm — a quick estimate from GC content. It also accepts mixed bases like N, R, and Y.
Nearest Neighbor — the most exact method. It uses base-stacking energy plus your salt and primer amounts.
Polymerase-specific — matches the Tm model to your enzyme (SuperFi, Phusion/Phire, or Taq) and suggests an annealing temperature.

You also get the primer length, GC percent, molecular weight, extinction coefficient (ε₂₆₀), and the reverse complement sequence. A step-by-step solution shows every part of the math, so you can check the work or learn how it is done. Charts show your results, and you can download everything as a CSV or Excel file.

How to use our Tm Calculator

Type in your primer sequence, pick a method, and set your reaction conditions. The calculator gives you the melting temperature (Tm), GC content, molecular weight, thermodynamic values (ΔH and ΔS), and a suggested annealing temperature, plus step-by-step math and charts.

Input mode: Choose "Single pair" to check one or two primers. Choose "Batch" to check many primer pairs at once.

Calculation method: Pick "Basic Tm" for a quick GC or Wallace estimate (this one allows mixed bases). Pick "Nearest Neighbor" for the most accurate Tm using base stacking, salt, and primer concentration. Pick "Polymerase-specific" to match the Tm model to your enzyme and get an annealing temperature.

DNA polymerase: This box shows only for the polymerase-specific method. Select the enzyme you use: Platinum SuperFi, Phusion/Phire, or DreamTaq/Taq. Each one uses its own annealing temperature rule.

Primer concentration: Enter your total single-strand primer amount and pick the unit (nM, µM, mM, or M). A common PCR value is 200 nM. If you need to work back from a stock tube, our Molarity Calculator and Dilution Calculator handle that step.

Salt (Na⁺) concentration: Enter the monovalent salt level in your reaction buffer and pick the unit. Most PCR buffers are near 50 mM.

Mg²⁺ concentration: Enter the magnesium level if you know it. The tool turns it into a sodium equivalent so the Tm is more accurate. Leave it at 0 to skip it.

Temperature output unit: Choose °C, °F, or K for all temperature results. To convert a thermocycler setting on its own, see the Celsius to Fahrenheit Calculator or the Temperature Calculator.

Thermodynamic output units: Choose kcal/mol with cal/(mol·K), or kJ/mol with J/(mol·K), for the ΔH and ΔS values.

Primer 1 (forward): Paste your 5′ to 3′ sequence, 6 to 50 bases long. Spaces, numbers, and FASTA headers are removed for you.

Primer 2 (reverse): Paste your second primer to compare both and get the Tm difference. Leave it blank to test just one primer.

Batch primer pairs: In batch mode, put one pair per line like this: F1 AGCTTGCATGCCTGCAGGTC ; R1 CTGGCCGTCGTTTTACAACG. Use "Clear batch input" to start over.

Calculate and Reset: Results update as you type, but you can press "Calculate" any time. Press "Reset" to bring back the example values. Then use the export buttons to save your results as CSV or Excel.

What Is Primer Melting Temperature (Tm)?

DNA is made of two strands that stick together. The melting temperature, or Tm, is the temperature where half of those strands come apart. For a PCR primer, the Tm tells you how warm the reaction can get before the primer stops holding onto the DNA template.

Knowing the Tm helps you pick the right annealing temperature for PCR. If the reaction is too hot, the primer will not bind and you get no product. If it is too cool, the primer sticks in the wrong places and you get extra bands or smears.

What Changes a Primer's Tm

Length: Longer primers grip harder, so the Tm goes up.
GC content: G–C pairs are held by three hydrogen bonds, while A–T pairs have only two. More G and C means a higher Tm.
Base order: Neighboring bases stack on each other. The same bases in a different order can give a slightly different Tm.
Salt (Na⁺ and Mg²⁺): Salt ions hide the negative charge on DNA, so the strands stay together longer. More salt raises the Tm.
Primer amount: Higher primer concentration pushes the strands to pair up, which nudges the Tm up a little.

The Three Ways Tm Is Figured Out

Basic Tm

A quick estimate from length and GC count. Short primers (under 14 bases) use the Wallace rule: add 2 °C for every A or T and 4 °C for every G or C. Longer primers use a GC-content formula. This method ignores salt, so it is a rough guess. It is the only method here that accepts mixed (degenerate) base codes like N, R, or Y.

Nearest Neighbor

The most accurate method. It looks at every pair of side-by-side bases and adds up their heat (ΔH) and disorder (ΔS) values, then corrects for salt and primer concentration. This is the standard used by most primer design tools. It needs plain A, T, G, and C bases only. The salt correction uses a natural log term, which you can explore further with our Log Calculator.

Polymerase-Specific

Different enzyme makers use slightly different math, so their suggested temperatures do not always match. This option uses the model that fits your enzyme and then gives a recommended annealing temperature:

Platinum SuperFi: lowest primer Tm + 3 °C
Phusion / Phire: lowest Tm + 3 °C for primers 20 bases or shorter, + 7 °C for longer ones
DreamTaq / Taq: lowest Tm − 5 °C

What Makes a Good Primer

Length	18–25 bases
GC content	40–60%
Tm	55–65 °C
Tm gap between the two primers	under 5 °C

A big Tm gap between the forward and reverse primer is a common cause of failed PCR. One primer binds well while the other does not, so only one strand gets copied well. If you want to see how far apart two values sit in relative terms, the Percent Difference Calculator is handy.

Other Numbers You Get

Along with Tm, you also see the molecular weight (useful for turning a mass of dried primer into moles — see the Molecular Weight Calculator and Mole Calculator for related work), the extinction coefficient at 260 nm (used with a spectrophotometer reading to find concentration), the GC percent, and the reverse complement of your sequence.

Treat every calculated Tm as a starting point, not a final answer. Real reactions also depend on your buffer, additives like DMSO, template quality, and the machine you use. A Buffer Calculator and pH Calculator help you keep those buffer conditions steady, and a Serial Dilution Calculator is useful when setting up template dilutions. If your first PCR is weak, try a gradient of annealing temperatures a few degrees above and below the value shown here.

Working on other bench or classroom problems? You may also find our Punnett Square Calculator, Peptide Mass Calculator, Stoichiometry Calculator, and PPM Calculator useful. For summarizing replicate Tm measurements, try the Standard Deviation Calculator or the Average Calculator.

Formulas used

Wallace rule Tm (sequences shorter than 14 bases)

T_m = 2(n_A + n_T) + 4(n_G + n_C)

GC-content Tm estimate (14 bases or longer)

T_m = 64.9 + 41 \times \frac{(n_G + n_C) - 16.4}{n}

Nearest-neighbor melting temperature (two-state model)

T_m = \frac{\Delta H^\circ}{\Delta S_{salt} + R\ln\left(\frac{C_T}{4}\right)} - 273.15

Salt-corrected entropy

\Delta S_{salt} = \Delta S^\circ + 0.368\,(n-1)\ln[Na^+]_{eq}

Monovalent equivalent salt concentration

[Na^+]_{eq} = [Na^+] + 120\sqrt{[Mg^{2+}]}

Empirical salt-adjusted Tm (Taq / DreamTaq)

T_m = 100.5 + 41\,\frac{n_G + n_C}{n} - \frac{820}{n} + 16.6\log_{10}[Na^+]

Recommended annealing temperature

T_a = \min\left(72,\ \max\left(37,\ T_{m,\mathrm{lower}} + \delta\right)\right),\quad \delta = \begin{cases} +3 & \text{SuperFi}\\ +3 & \text{Phusion},\ L \le 20\\ +7 & \text{Phusion},\ L > 20\\ -5 & \text{Taq} \end{cases}

Molecular weight and extinction coefficient of the oligo

MW = 313.21 n_A + 304.20 n_T + 329.21 n_G + 289.18 n_C - 61.96,\quad \varepsilon_{260} = 15400 n_A + 8700 n_T + 11500 n_G + 7400 n_C

Frequently asked questions

Why do the three methods give me different Tm values?

Each method uses different math. Basic Tm only looks at length and GC count. Nearest Neighbor adds base stacking energy, salt, and primer amount. Polymerase-specific uses the model that enzyme makers built into their own tools.

Gaps of 3–8 °C between methods are normal. Pick one method and stick with it so your primers can be compared fairly.

Which Tm method should I use for PCR?

Use Nearest Neighbor for most work. It is the most accurate and matches what most primer design software reports.

Use Polymerase-specific when you want a ready-to-use annealing temperature for your enzyme. Use Basic Tm only for a fast check or when your primer has mixed bases.

Why does my sequence show an error when I use mixed bases like N or R?

Nearest Neighbor and polymerase-specific methods need real stacking values for each base pair. Mixed codes such as N, R, Y, S, W, K, M, B, D, H, and V have no single value, so those methods reject them.

Switch to Basic Tm to calculate a degenerate primer, or replace the mixed base with the most likely letter.

Why is my primer sequence rejected for being too short or too long?

The tool accepts 6 to 50 bases. Under 6 bases the math is meaningless, and over 50 bases the two-state melting model stops being reliable.

Most PCR primers sit at 18–25 bases, which is well inside this range.

Do I have to enter a Mg²⁺ concentration?

No. You can leave it at 0. But magnesium raises the Tm, so adding it makes the result closer to real life.

Most PCR mixes use 1.5–2 mM Mg²⁺. The tool turns it into a sodium equivalent with the formula [Na⁺]eq = [Na⁺] + 120 × √[Mg²⁺].

Why does the Mg²⁺ box disappear sometimes?

The Mg²⁺ field only shows for the Nearest Neighbor method. Basic Tm ignores salt completely, and the polymerase-specific models use only the monovalent salt value.

The primer and salt boxes hide for Basic Tm for the same reason.

What primer concentration should I enter?

Enter the amount of one single primer in the final reaction, not the combined amount of both. A standard PCR value is 200 nM (0.2 µM).

Changing this number moves the Tm only a little. Doubling it shifts Tm by roughly 1 °C.

Why is the annealing temperature capped at 72 °C?

72 °C is the usual extension temperature for most DNA polymerases. Annealing above that point makes the annealing and extension steps blend together.

The tool also sets a floor at 37 °C, since colder steps cause primers to bind the wrong spots. If the raw value falls outside the window, the tool tells you it was limited.

My two primers have a big Tm gap. What should I do?

Aim for a gap under 5 °C. To close it, trim a base or two off the hotter primer, or add a base to the cooler one.

You can also shift the primer a few bases along the template to land in a spot with better GC balance.

What does ΔH and ΔS mean in the results?

ΔH (enthalpy) is the heat released when the strands pair up. ΔS (entropy) is the loss of freedom when two loose strands become one ordered duplex.

Both are negative for binding. The Tm formula divides ΔH by ΔS plus a concentration term. The ΔS shown is already salt-corrected.

How do I use the extinction coefficient (ε₂₆₀)?

Use it with a spectrophotometer reading at 260 nm. Concentration (M) = A260 ÷ (ε₂₆₀ × path length in cm).

For a standard 1 cm cuvette, just divide your A260 reading by the ε₂₆₀ shown in the results table.

What is the reverse complement used for?

It is the sequence of the opposite DNA strand, written 5′ to 3′. You need it to design a reverse primer from a template strand.

Click the Copy button next to it to put it on your clipboard.

Can I paste a FASTA sequence?

Yes. The tool strips the header line that starts with >, plus spaces, line numbers, and other symbols.

A note appears under the box telling you that formatting characters were removed.

How do I format batch input correctly?

Put one primer pair per line. Separate the two primers with a semicolon, and separate each ID from its sequence with a space:

F1 AGCTTGCATGCCTGCAGGTC ; R1 CTGGCCGTCGTTTTACAACG

You can also list a single primer per line. Bad lines are flagged with a message instead of stopping the whole batch.

Can I sort the batch results table?

Yes. Click any column heading to sort by that value. Click it again to flip between low-to-high and high-to-low.

Sorting by Tm is a quick way to spot primers that fall outside your target range.

Why do only some primers show ΔH and ΔS?

Only Nearest Neighbor and the SuperFi and Phusion polymerase models calculate thermodynamic values.

Basic Tm and the DreamTaq/Taq model use empirical formulas based on GC content, so they have no ΔH or ΔS to report.

Does the calculator check for hairpins or primer dimers?

No. It calculates Tm and sequence stats only. It does not look for self-folding, dimers, or template matches.

Check those separately before ordering primers, especially if the 3′ ends of your two primers can pair with each other.

Does DMSO or another additive change the Tm?

Yes, but this tool does not model it. DMSO lowers Tm by roughly 0.6 °C per 1% added. Formamide and betaine also shift it.

If you use additives, subtract the expected drop yourself or run a gradient PCR.

Can I use this for qPCR probes or RNA primers?

The math here is for DNA-DNA pairing. TaqMan probes and RNA duplexes use different stacking values, so results will be off.

Use it as a rough guide only, and remember probes are usually designed to melt about 8–10 °C above the primers.

My PCR still fails even at the suggested annealing temperature. What now?

Run a gradient PCR spanning about 5 °C above and below the suggested value. Every calculated Tm is a starting point, not a guarantee.

Also check your template quality, Mg²⁺ level, and whether the primers form dimers.

Why does the Tm change when I switch temperature units?

The number changes but the temperature does not. The tool converts the same result into °C, °F, or K.

For Tm differences, °C and K gaps are identical, while a °F gap is 1.8 times larger.

What do the exported CSV and Excel files contain?

Both hold one row per primer with the ID, sequence, length, GC percent, molecular weight, extinction coefficient, Tm, ΔH, ΔS, annealing temperature, and the model used.

In batch mode, only valid primers are exported. Lines with errors are skipped.

Is the molecular weight for single-stranded or double-stranded DNA?

It is for the single-stranded primer, with the standard 61.96 correction for a 5′ hydroxyl end.

If your primer has a 5′ phosphate, a fluorescent dye, or another modification, add that mass yourself.

Rate this calculator